Galaxy | Published Workflow | Assembling the R. sphaeroides genome using SOAPdenovo2

None

Published Workflows | peterli | Assembling the R. sphaeroides genome using SOAPdenovo2

Galaxy Workflow ' Assembling the R. sphaeroides genome using SOAPdenovo2'

Step	Annotation
Step 1: Input dataset Input Dataset select at runtime	frag_1.fastq
Step 2: Input dataset Input Dataset select at runtime	frag_2.fastq
Step 3: Input dataset Input Dataset select at runtime	genome.fasta
Step 4: Input dataset Input Dataset select at runtime	shortjump_1.fastq
Step 5: Input dataset Input Dataset select at runtime	shortjump_2.fastq
Step 6: KmerFreq AR What type of data are you using? FASTQ library libraries 1 Forward FASTQ file Output dataset 'output' from step 1 Reverse FASTQ file Output dataset 'output' from step 2 Kmerfreq AR analysis to perform Consecutive Kmer size 17 Minimum precision kmer rate -1 ASCII shift of the quality value 33 Output kmers depth file? YES Total bases number used to get kmers None
Step 7: SOAPfilter Forward set of reads Output dataset 'output' from step 4 Reverse set of reads Output dataset 'output' from step 5 Filter settings to use Full parameter list Trim flag Unify trimming Length of read to be trimmed at 5' end of read1 0 Length of read to be trimmed at 3' end of read1 50 Length of read to be trimmed at 5' end of read2 0 Length of read to be trimmed at 3' end of read2 50 Quality shift value 33 Number of paired reads in buffer 2000000 Filter out low quality bases? 50 Library insert size 4000 Percentage of N bases in reads which should be filtered out? 10 Filter out adapter sequence from reads? No Adapter sequence for read 1 AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG Adapter sequence for read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Filter small-sized reads? No Filter out PCR duplications? Yes Compress results? No
Step 8: Corrector AR Corrector AR analysis to perform Consecutive List of input files Output dataset 'filelist' from step 6 Compressed frequency file of consecutive Kmer frequency data Output dataset 'cz' from step 6 Block length of consecutive kmer compressed file Output dataset 'cz_len' from step 6 Kmer size 17 Consecutive kmer low frequency cutoff 3 ASCII shift of the quality value 33 Correction AR settings to use Full parameter list Minimum length of a continuous high frequency Kmer region 5 Maximum number of bases that can be changed in a single read 5 Maximum number of bases allowed in a branch and bound tree 15000000 Remove low quality or suspicious data No Trim suspicious region at the end of reads according to Q_value? Yes - trim Q_value to less than or equal 2 continues region Trim error bases with Q value until it is less than or equal to 2 instead of correcting it No, correct this base Set quality threshold of error bases 30 Number of bases to trim from low quality read ends. Defaults to Kmer size/2 8 Minimum length of trimmed reads 50 Convert read1 and read2 corrected files into paired-end files Yes Output file format FASTQ compressed file
Step 9: SOAPdenovo2 Select a configuration file from history or create a new one? Create new configuration file Maximum read length 100 library libraries 1 Average insert size 180 Reverse sequence? forward-reverse Which operations should the reads be used for? For contig and scaffold assembly Length of base pairs to use from reads None Which order are the reads used while scaffolding 1 Pair number cutoff for a reliable connection None Length of contig that has to be aligned for a reliable read location None files files 1 What type of data are you using? Paired What is the format of your sequence data? FASTQ_GZIPPED Forward FASTQ Gzipped file Output dataset 'corrected_forward' from step 8 Reverse FASTQ Gzipped file Output dataset 'corrected_reverse' from step 8 files 2 What type of data are you using? Single What type of data are you using? FASTQ_GZIPPED Forward FASTQ Gzipped file Output dataset 'corrected_single' from step 8 libraries 2 Average insert size 4000 Reverse sequence? reverse-forward Which operations should the reads be used for? For only scaffold assembly Length of base pairs to use from reads None Which order are the reads used while scaffolding 2 Pair number cutoff for a reliable connection 11 Length of contig that has to be aligned for a reliable read location 35 files files 1 What type of data are you using? Paired What is the format of your sequence data? FASTQ Forward FASTQ file Output dataset 'read1_clean' from step 7 Reverse FASTQ file Output dataset 'read2_clean' from step 7 k-value in kmer 19 Delete kmers with frequency no larger than? 1 Resolve repeats by reads Yes Fill gaps in scaffold? Yes SOAP settings to use Default
Step 10: GapCloser 1.12 Scaffold file for gap closing Output dataset 'scafseq' from step 9 Select a configuration file from history or create a new one? Use one from history Select configuration file from history Output dataset 'config' from step 9 GapCloser settings to use Full parameter list Overlap parameter 19 Maximal read length 60
Step 11: Extract ACGT scaffolds Output dataset 'scaff' from step 10
Step 12: GAGE analysis Reference genome file in FASTA format Output dataset 'output' from step 3 Contig file in FASTA format Output dataset 'scafseq_gc_ctg_fa' from step 11 Scaffold file in FASTA format Output dataset 'scaff' from step 10
Step 13: stat GAGE output Output dataset 'outfile' from step 12

About this Workflow

Author

peterli

Related Workflows

All published workflows
Published workflows by peterli

Rating

Community
(0 ratings, 0.0 average)

Tags

Community: none