Galaxy | Published Workflow | Assembling the R. sphaeroides genome using SOAPdenovo1

None

Published Workflows | peterli | Assembling the R. sphaeroides genome using SOAPdenovo1

Galaxy Workflow ' Assembling the R. sphaeroides genome using SOAPdenovo1'

Step	Annotation
Step 1: Input dataset Input Dataset select at runtime
Step 2: Input dataset Input Dataset select at runtime
Step 3: Input dataset Input Dataset select at runtime
Step 4: Input dataset Input Dataset select at runtime
Step 5: Input dataset Input Dataset select at runtime
Step 6: KmerFreq1 What type of data are you using? FASTQ library libraries 1 Forward FASTQ file Output dataset 'output' from step 1 Reverse FASTQ file Output dataset 'output' from step 2 Seed length 17 ASCII shift of the quality value 33 Quality cutoff 0 Output Kmer index Yes
Step 7: SOAPfilter Forward set of reads Output dataset 'output' from step 4 Reverse set of reads Output dataset 'output' from step 5 Filter settings to use Full parameter list Trim flag Unify trimming Length of read to be trimmed at 5' end of read1 0 Length of read to be trimmed at 3' end of read1 50 Length of read to be trimmed at 5' end of read2 0 Length of read to be trimmed at 3' end of read2 50 Quality shift value 33 Number of paired reads in buffer 2000000 Filter out low quality bases? 50 Library insert size 4000 Percentage of N bases in reads which should be filtered out? 10 Filter out adapter sequence from reads? No Adapter sequence for read 1 AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG Adapter sequence for read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Filter small-sized reads? No Filter out PCR duplications? Yes Compress results? No
Step 8: Corrector1 List of input files Output dataset 'filelist' from step 6 Kmer frequency data Output dataset 'freq' from step 6 Kmer index Yes Start of Kmer frequency cutoff 3 End of Kmer frequency cutoff 3 Delta value 2 Seed length 17 Input file format FASTQ
Step 9: Merge pair List of corrected read files Output dataset 'corr_filelist' from step 8
Step 10: SOAPdenovo1 Select a configuration file from history or create a new one? Create new configuration file Maximum read length 100 library libraries 1 Average insert size 180 Reverse sequence? forward-reverse Which operations should the reads be used for? For contig and scaffold assembly Length of base pairs to use from reads None Which order are the reads used while scaffolding 1 Pair number cutoff for a reliable connection None Length of contig that has to be aligned for a reliable read location None files files 1 What type of data are you using? Single What type of data are you using? Paired reads Single fasta file for paired reads Output dataset 'pair' from step 9 files 2 What type of data are you using? Single What type of data are you using? FASTA Forward FASTA file Output dataset 'single' from step 9 libraries 2 Average insert size 4000 Reverse sequence? reverse-forward Which operations should the reads be used for? For only scaffold assembly Length of base pairs to use from reads None Which order are the reads used while scaffolding 2 Pair number cutoff for a reliable connection None Length of contig that has to be aligned for a reliable read location 35 files files 1 What type of data are you using? Paired What is the format of your sequence data? FASTQ Forward FASTQ file Output dataset 'read1_clean' from step 7 Reverse FASTQ file Output dataset 'read2_clean' from step 7 SOAP settings to use Full parameter list k value in kmer 23 Number of CPUs to use 16 Delete kmers that are only found once? Yes Delete edges that are only found once? No Unsolve repeats by reads? Yes Fill gaps in scaffold? No
Step 11: GapCloser 1.10 Scaffold file for gap closing Output dataset 'scafseq' from step 10 Select a configuration file from history or create a new one? Create new configuration file Maximum read length 70 library libraries 1 Average insert size 180 Reverse sequence? forward-reverse Which operations should the reads be used for? For contig and scaffold assembly Length of base pairs to use from reads None Which order are the reads used while scaffolding 1 Pair number cutoff for a reliable connection None Length of contig that has to be aligned for a reliable read location None files files 1 What type of data are you using? Single What type of data are you using? Paired reads Single fasta file for paired reads Output dataset 'pair' from step 9 files 2 What type of data are you using? Single What type of data are you using? FASTA Forward FASTA file Output dataset 'single' from step 9 libraries 2 Average insert size 4000 Reverse sequence? reverse-forward Which operations should the reads be used for? For only scaffold assembly Length of base pairs to use from reads None Which order are the reads used while scaffolding 2 Pair number cutoff for a reliable connection None Length of contig that has to be aligned for a reliable read location 35 files files 1 What type of data are you using? Paired What is the format of your sequence data? FASTQ Forward FASTQ file Output dataset 'read1_clean' from step 7 Reverse FASTQ file Output dataset 'read2_clean' from step 7 GapCloser settings to use Full parameter list Overlap parameter 23 Number of threads for processing 16
Step 12: Extract ACGT scaffolds Output dataset 'scaff' from step 11
Step 13: GAGE analysis Reference genome file in FASTA format Output dataset 'output' from step 3 Contig file in FASTA format Output dataset 'scafseq_gc_ctg_fa' from step 12 Scaffold file in FASTA format Output dataset 'scaff' from step 11
Step 14: stat GAGE output Output dataset 'outfile' from step 13

About this Workflow

Author

peterli

Related Workflows

All published workflows
Published workflows by peterli

Rating

Community
(0 ratings, 0.0 average)

Tags

Community: none