Welcome to Galaxy
It appears that you found this tool from a link outside of Galaxy. If you're not familiar with Galaxy, please consider visiting the welcome page. To learn more about what Galaxy is and what it can do for you, please visit the Galaxy wiki.

Extract ACGT (Galaxy tool version 0.1)

What it does

The main purpose of this tool is to extract continuous ACGT sequences from scaffolds, thereby breaking scaffolds at 'N' regions.

For example, if the scaffold sequence is:

ATGCCGTAGATTGAAGCAGAGGGCCGNNNNNNNNNNNNTAGATACAGGTTGCTCTAGACAGAG

Then this scaffold will be broken into two sequences:

ATGCCGTAGATTGAAGCAGAGGGCCG and TAGATACAGGTTGCTCTAGACAGAG

Attribution

This tool was written by Ruan Jue @ BGI-SZ.


This tool was installed from a ToolShed, you may be able to find additional information by following this link: http://gigatoolshed.net/view/peterli/extract_acgt